Stem-loop sequence efu-mir-181f

AccessionMI0028693 (change log)
DescriptionEptesicus fuscus miR-181f stem-loop
Gene family MIPF0000007; mir-181
Stem-loop
   --  cu      a   u      cu       a    ggga 
5'   ga  ccaagg aca ucaacg  gucggug guuu    u
     ||  |||||| ||| ||||||  ||||||| ||||    u
3'   cu  gguucc ugu aguugc  cagccac caaa    u
   uc  cg      a   c      --       -    aaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EptFus1.0; GCA_000308155.1) Overlapping transcripts
JH977726.1: 2031528-2031607 [+]
intergenic
Clustered miRNAs
< 10kb from efu-mir-181f
efu-mir-181fJH977726.1: 2031528-2031607 [+]
efu-mir-181eJH977726.1: 2032731-2032810 [+]
Database links

Mature sequence efu-miR-181f

Accession MIMAT0035008
Sequence

49 - 

accaccgaccguugacuguacc

 - 70

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).