Stem-loop sequence efu-mir-26c

AccessionMI0028691 (change log)
DescriptionEptesicus fuscus miR-26c stem-loop
Gene family MIPF0000043; mir-26
Stem-loop
   --   gg ug  uu         c          guuuc  c 
5'   ugu  c  ga  caaguaauc aggauaggcu     ca c
     |||  |  ||  ||||||||| ||||||||||     ||  
3'   acg  g  cu  guucauuag ucuuauccgg     gu u
   cg   ga gu  uu         u          ----a  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EptFus1.0; GCA_000308155.1) Overlapping transcripts
JH977659.1: 2129710-2129789 [-]
intergenic
Database links

Mature sequence efu-miR-26c

Accession MIMAT0035006
Sequence

11 - 

uucaaguaauccaggauaggcuguu

 - 35

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).