Stem-loop sequence efu-mir-20

AccessionMI0028681 (change log)
DescriptionEptesicus fuscus miR-20 stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
   --ucu    c   -a                 g   -  uu 
5'      guag acu  aagugcuuauagugcag uag ug  u
        |||| |||  ||||||||||||||||| ||| ||   
3'      cguc uga  uucacgaguauuacguc auc au  a
   ucgau    a   aa                 -   u  ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EptFus1.0; GCA_000308155.1) Overlapping transcripts
JH977750.1: 95905-95983 [+]
intergenic
Clustered miRNAs
< 10kb from efu-mir-20
efu-mir-17JH977750.1: 95455-95538 [+]
efu-mir-18JH977750.1: 95596-95680 [+]
efu-mir-20JH977750.1: 95905-95983 [+]
efu-mir-92cJH977750.1: 96157-96235 [+]
Database links

Mature sequence efu-miR-20

Accession MIMAT0034996
Sequence

11 - 

uaaagugcuuauagugcagguagug

 - 35

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).