Stem-loop sequence efu-mir-127

AccessionMI0028619 (change log)
DescriptionEptesicus fuscus miR-127 stem-loop
Gene family MIPF0000080; mir-127
Stem-loop
   ----a   ucu      ugcug         g  c      --  a 
5'      cug   ccagcc     aagcucaga gg ucugau  uc g
        |||   ||||||     ||||||||| || ||||||  || a
3'      ggc   ggucgg     uucgagucu cc aggcua  ag a
   cugaa   --u      -----         g  u      cu  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EptFus1.0; GCA_000308155.1) Overlapping transcripts
JH977717.1: 986736-986817 [-]
intergenic
Clustered miRNAs
< 10kb from efu-mir-127
efu-mir-337JH977717.1: 994518-994598 [-]
efu-mir-127JH977717.1: 986736-986817 [-]
efu-mir-136JH977717.1: 985070-985145 [-]
Database links

Mature sequence efu-miR-127

Accession MIMAT0034933
Sequence

49 - 

aucggauccgucugagcuuggcug

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).