Stem-loop sequence efu-mir-215

AccessionMI0028610 (change log)
DescriptionEptesicus fuscus miR-215 stem-loop
Gene family MIPF0000063; mir-192
Stem-loop
   --         a a  a     -   u         g g g 
5'   uguacagga a ug ccuau gaa ugacagaca u u g
     ||||||||| | || ||||| ||| ||||||||| | | c
3'   auaugucuu u ac ggaug cuu acugucugu a a u
   cu         a a  c     u   u         g g a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EptFus1.0; GCA_000308155.1) Overlapping transcripts
JH977666.1: 4371074-4371155 [+]
intergenic
Clustered miRNAs
< 10kb from efu-mir-215
efu-mir-194-1JH977666.1: 4370823-4370900 [+]
efu-mir-215JH977666.1: 4371074-4371155 [+]
Database links

Mature sequence efu-miR-215

Accession MIMAT0034925
Sequence

11 - 

aaugaccuaugaauugacagaca

 - 33

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).