Stem-loop sequence efu-mir-194-1

AccessionMI0028609 (change log)
DescriptionEptesicus fuscus miR-194-1 stem-loop
Gene family MIPF0000055; mir-194
Stem-loop
   --  uu      u         a      g    --c  a 
5'   ag  aucaag guaacagca cuccau ugga   ug g
     ||  |||||| ||||||||| |||||| ||||   || u
3'   uu  uaguuu cauugucgu gaggug accu   ac a
   ca  gg      u         a      -    uua  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EptFus1.0; GCA_000308155.1) Overlapping transcripts
JH977666.1: 4370823-4370900 [+]
intergenic
Clustered miRNAs
< 10kb from efu-mir-194-1
efu-mir-194-1JH977666.1: 4370823-4370900 [+]
efu-mir-215JH977666.1: 4371074-4371155 [+]
Database links

Mature sequence efu-miR-194

Accession MIMAT0034924
Sequence

11 - 

uguaacagcaacuccaugugga

 - 32

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).