Stem-loop sequence efu-mir-101

AccessionMI0028598 (change log)
DescriptionEptesicus fuscus miR-101 stem-loop
Gene family MIPF0000046; mir-101
Literature search

1 open access papers mention efu-mir-101
(1 sentences)

Stem-loop
   --       cuggc                  a    gucca 
5'   ggcugcc     ucaguuaucacagugcug ugcu     u
     |||||||     |||||||||||||||||| ||||      
3'   ccgacgg     agucaauagugucaugac augg     u
   aa       uagga                  -    aaauc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EptFus1.0; GCA_000308155.1) Overlapping transcripts
JH977620.1: 15004278-15004360 [-]
intergenic
Database links

Mature sequence efu-miR-101

Accession MIMAT0034913
Sequence

49 - 

guacaguacugugauaacugaagga

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).