Stem-loop sequence eca-mir-9183

AccessionMI0028413 (change log)
DescriptionEquus caballus miR-9183 stem-loop
Stem-loop
   --cgcc  gc   u   aaacucauu      agac     ----           -------      a   c   uu  cu 
5'       gg  cug cgu         accucc    gucuc    gccggcucgau       ggcuuu uga aac  gg  c
         ||  ||| |||         ||||||    |||||    |||||||||||       |||||| ||| |||  ||   
3'       cc  gac gca         uggggg    cgggg    cgguugggcua       ccggaa acu uug  cc  g
   cgucuu  ac   -   ---------      ----     acgu           uggaucc      -   u   -u  uu 
Get sequence
Deep sequencing
4 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr18: 54585543-54585681 [-]
intergenic
Database links

Mature sequence eca-miR-9183

Accession MIMAT0034764
Sequence

41 - 

ccggcucgauggcuuuaugaca

 - 62

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).