Stem-loop sequence eca-mir-9180

AccessionMI0028410 (change log)
DescriptionEquus caballus miR-9180 stem-loop
Stem-loop
   -----cugca   cugccu      cacg     a  -   uuua        cc     gug    
5'           ggg      gguggc    ucugg gc ccc    agaggucc  agccu   ccu 
             |||      ||||||    ||||| || |||    ||||||||  |||||   || g
3'           ccu      ccaccg    agacc cg ggg    ucuccagg  ucggg   ggg 
   accucuacug   -cuucc      acaa     -  a   -uag        -u     --a    
Get sequence
Deep sequencing
24 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr19: 33436526-33436646 [+]
intergenic
Database links

Mature sequence eca-miR-9180

Accession MIMAT0034761
Sequence

69 - 

cuuggaccucugaugggagccca

 - 91

Get sequence
Deep sequencing23 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).