Stem-loop sequence eca-mir-191b

AccessionMI0028398 (change log)
DescriptionEquus caballus miR-191b stem-loop
Gene family MIPF0000194; mir-191
Literature search

2 open access papers mention eca-mir-191b
(2 sentences)

Stem-loop
   acuaaga    g  -ca   a a g   a  g    a     -   c       gaa  -  c 
5'        cgcu cu   ggc g a agc gg aacg aaucc aag gcagcug   ug cu u
          |||| ||   ||| | | ||| || |||| ||||| ||| |||||||   || ||  
3'        gcgg gg   ccg c u ucg cc uugc uuagg uuu cgucgac   ac ga g
   ----ggg    g  uug   a c g   c  g    c     g   u       --a  a  g 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr16: 38001138-38001256 [-]
intergenic
Clustered miRNAs
< 10kb from eca-mir-191b
eca-mir-425chr16: 38001590-38001732 [+]
eca-mir-191achr16: 38001159-38001232 [+]
eca-mir-191bchr16: 38001138-38001256 [-]
Database links

Mature sequence eca-miR-191b

Accession MIMAT0034750
Sequence

31 - 

gaacgaaauccaagcgcagcug

 - 52

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).