Stem-loop sequence eca-mir-425

AccessionMI0028397 (change log)
DescriptionEquus caballus miR-425 stem-loop
Gene family MIPF0000242; mir-425
Literature search

1 open access papers mention eca-mir-425
(1 sentences)

Stem-loop
   ---   c c     g   gccu c   a g     c  u    aau        cac     uugagug   aca 
5'    guc c ggguc ugc    g ggc u gaaag gc uugg   gacacgau   ucccg       ggc   c
      ||| | ||||| |||    | ||| | ||||| || ||||   ||||||||   |||||       |||   a
3'    cgg g uccag acg    c ccg g cuuuc cg gacc   cugugcua   agggc       ccg   a
   ucc   a u     g   -acc u   c g     u  u    cgc        -ua     -----ua   aag 
Get sequence
Deep sequencing
1208 reads, 50 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr16: 38001590-38001732 [+]
intergenic
Clustered miRNAs
< 10kb from eca-mir-425
eca-mir-191bchr16: 38001138-38001256 [-]
eca-mir-191achr16: 38001159-38001232 [+]
eca-mir-425chr16: 38001590-38001732 [+]
Database links

Mature sequence eca-miR-425

Accession MIMAT0034749
Sequence

80 - 

ccaucgggaauaucguguccgccc

 - 103

Get sequence
Deep sequencing71 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).