Stem-loop sequence eca-mir-9158

AccessionMI0028382 (change log)
DescriptionEquus caballus miR-9158 stem-loop
Stem-loop
   -------uc        g   g g     c       g 
5'          aauuuuau gaa a uuuga aggauug u
            |||||||| ||| | ||||| |||||||  
3'          uuaagaug uuu u gaauu ucuuaau a
   agugaucac        g   g -     -       u 
Get sequence
Deep sequencing
3 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr14: 32675289-32675357 [-]
intergenic
Database links

Mature sequence eca-miR-9158

Accession MIMAT0034735
Sequence

43 - 

uaaguguuugguagaauucacu

 - 64

Get sequence
Deep sequencing3 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).