Stem-loop sequence eca-mir-9155

AccessionMI0028378 (change log)
DescriptionEquus caballus miR-9155 stem-loop
Stem-loop
   aaa    a         agcaacaa     cauu     u  u   -   -----   - -      - ug  uc 
5'    gcuu cuaacuuaa        ugacu    cucca gc ucu gua     ggu c ggcggg g  gc  c
      |||| |||||||||        |||||    ||||| || ||| |||     ||| | |||||| |  ||   
3'    ugga gguuggguu        acugg    gaggu cg agg cgu     uca g ccgucu c  cg  u
   ccc    a         -------g     ----     -  u   u   aaaac   a u      u gu  uc 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr14: 19191619-19191749 [-]
intergenic
Database links

Mature sequence eca-miR-9155

Accession MIMAT0034731
Sequence

36 - 

uccaugcuucuguaggucggcgg

 - 58

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).