Stem-loop sequence eca-mir-8908i

AccessionMI0028365 (change log)
DescriptionEquus caballus miR-8908i stem-loop
Gene family MIPF0001890; mir-8908
Stem-loop
   -----------  c         acuuugagcca      -    ag   c        ua             uuag 
5'            gg agauccucc           uucugu gugc  ugc cuacccgg  agguagugaucac    a
              || |||||||||           |||||| ||||  ||| ||||||||  |||||||||||||    u
3'            cu ucugggagg           aggaca cacg  aug gguggguc  uccgucacuagug    g
   ucguggucaga  -         -guuuguaaca      a    ca   a        ug             ugga 
Get sequence
Deep sequencing
7454 reads, 500 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chrX: 115876504-115876648 [-]
intergenic
Clustered miRNAs
< 10kb from eca-mir-8908i
eca-mir-9142chrX: 115885618-115885738 [-]
eca-mir-8908hchrX: 115879532-115879676 [-]
eca-mir-8908b-1chrX: 115877541-115877631 [-]
eca-mir-8908ichrX: 115876504-115876648 [-]
eca-mir-8908b-2chrX: 115875682-115875772 [-]
eca-mir-8908echrX: 115874599-115874743 [-]
eca-mir-8908c-3chrX: 115873249-115873393 [-]
eca-mir-8908l-1chrX: 115871267-115871411 [-]
eca-mir-8908b-4chrX: 115870758-115870898 [-]
eca-mir-8908g-1chrX: 115869760-115869842 [-]
eca-mir-8908f-4chrX: 115868381-115868481 [-]
eca-mir-8908d-1chrX: 115867856-115867974 [-]
eca-mir-8908jchrX: 115867008-115867102 [-]
Database links

Mature sequence eca-miR-8908i

Accession MIMAT0034719
Sequence

41 - 

uacccgguaagguagugaucacuua

 - 65

Get sequence
Deep sequencing7394 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).