Stem-loop sequence eca-mir-8908f-4

AccessionMI0028362 (change log)
DescriptionEquus caballus miR-8908f-4 stem-loop
Gene family MIPF0001890; mir-8908
Stem-loop
   -----cagug    -gu   -gu    u             c    c    ag 
5'           cugu   gca   gucc acucagaaaggua ugau acuu  a
             ||||   |||   |||| ||||||||||||| |||| ||||  g
3'           gaca   cgu   cagg ugggucuuuccgu acug ugaa  g
   guccaagaag    acu   agu    -             c    a    ca 
Get sequence
Deep sequencing
41 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chrX: 115868381-115868481 [-]
intergenic
Clustered miRNAs
< 10kb from eca-mir-8908f-4
eca-mir-8908b-1chrX: 115877541-115877631 [-]
eca-mir-8908ichrX: 115876504-115876648 [-]
eca-mir-8908b-2chrX: 115875682-115875772 [-]
eca-mir-8908echrX: 115874599-115874743 [-]
eca-mir-8908c-3chrX: 115873249-115873393 [-]
eca-mir-8908l-1chrX: 115871267-115871411 [-]
eca-mir-8908b-4chrX: 115870758-115870898 [-]
eca-mir-8908g-1chrX: 115869760-115869842 [-]
eca-mir-8908f-4chrX: 115868381-115868481 [-]
eca-mir-8908d-1chrX: 115867856-115867974 [-]
eca-mir-8908jchrX: 115867008-115867102 [-]
eca-mir-8908f-3chrX: 115866475-115866615 [-]
eca-mir-8908a-2chrX: 115865962-115866098 [-]
eca-mir-8908k-1chrX: 115865120-115865254 [-]
eca-mir-8908c-2chrX: 115864611-115864755 [-]
eca-mir-8908mchrX: 115862627-115862771 [-]
eca-mir-8908b-5chrX: 115862119-115862259 [-]
eca-mir-8908g-2chrX: 115861091-115861233 [-]
eca-mir-8908f-2chrX: 115859723-115859863 [-]
eca-mir-8908a-1chrX: 115859210-115859346 [-]
eca-mir-8908k-2chrX: 115858390-115858484 [-]
Database links

Mature sequence eca-miR-8908f

Accession MIMAT0034701
Sequence

21 - 

uacucagaaagguacugaucacu

 - 43

Get sequence
Deep sequencing136 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).