Stem-loop sequence eca-mir-8908l-2

AccessionMI0028355 (change log)
DescriptionEquus caballus miR-8908l-2 stem-loop
Gene family MIPF0001890; mir-8908
Stem-loop
   ugu   c uc  -----c     ug   -cau  ug   ---   g   c         a    u         uag 
5'    gcc g  cu      caccu  agc    uu  ugu   gca cgc cugcccaga uggu ccgauuacg   a
      ||| |  ||      |||||  |||    ||  |||   ||| ||| ||||||||| |||| |||||||||   u
3'    ugg c  ga      guggg  uug    aa  aca   cgu gcg gaugggucu accg ggcugaugu   u
   --g   a ga  cuuucu     gu   caac  gu   acu   a   a         -    u         gaa 
Get sequence
Deep sequencing
3827 reads, 200 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chrX: 115855806-115855950 [-]
intergenic
Clustered miRNAs
< 10kb from eca-mir-8908l-2
eca-mir-8908k-1chrX: 115865120-115865254 [-]
eca-mir-8908c-2chrX: 115864611-115864755 [-]
eca-mir-8908mchrX: 115862627-115862771 [-]
eca-mir-8908b-5chrX: 115862119-115862259 [-]
eca-mir-8908g-2chrX: 115861091-115861233 [-]
eca-mir-8908f-2chrX: 115859723-115859863 [-]
eca-mir-8908a-1chrX: 115859210-115859346 [-]
eca-mir-8908k-2chrX: 115858390-115858484 [-]
eca-mir-8908c-1chrX: 115857861-115858005 [-]
eca-mir-8908l-2chrX: 115855806-115855950 [-]
eca-mir-8908b-3chrX: 115855297-115855437 [-]
eca-mir-8908f-1chrX: 115854781-115854921 [-]
eca-mir-8908d-2chrX: 115854275-115854413 [-]
Database links

Mature sequence eca-miR-8908l

Accession MIMAT0034712
Sequence

41 - 

ccugcccagaaugguuccgauuacg

 - 65

Get sequence
Deep sequencing8 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).