Stem-loop sequence eca-mir-509b

AccessionMI0028347 (change log)
DescriptionEquus caballus miR-509b stem-loop
Gene family MIPF0000130; mir-506
Literature search

1 open access papers mention eca-mir-509b
(1 sentences)

Stem-loop
   ----  c       -   ----a a   uc  ug    g          -  a  a   g         g a 
5'     gg ugccauc cuu     g cau  gu  ugug uacucuacuc ca ag gug caaucaugu u a
       || ||||||| |||     | |||  ||  |||| |||||||||| || || ||| ||||||||| |  
3'     uc acgguag gga     c gua  ca  guac augaggugag gu uc cac guuagugua a u
   gaug  -       u   cacgg -   ca  gu    a          u  c  -   a         g u 
Get sequence
Deep sequencing
4190 reads, 150 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chrX: 116783204-116783336 [-]
intergenic
Clustered miRNAs
< 10kb from eca-mir-509b
eca-mir-509achrX: 116788793-116788890 [-]
eca-mir-509bchrX: 116783204-116783336 [-]
Database links

Mature sequence eca-miR-509b

Accession MIMAT0034709
Sequence

36 - 

uacuccaaagaguggcaaucaugu

 - 59

Get sequence
Deep sequencing109 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).