Stem-loop sequence eca-mir-506a

AccessionMI0028345 (change log)
DescriptionEquus caballus miR-506a stem-loop
Gene family MIPF0000130; mir-506
Literature search

1 open access papers mention eca-mir-506a
(1 sentences)

Stem-loop
   aaaaag    a  a gu    uu   cu     u     --g   - ------        gg   c  ug    c   ga 
5'       guua ga u  cacc  cag  acguu guuca   ugc c      uuacucag  agg gu  uuca aua  u
         |||| || |  ||||  |||  ||||| |||||   ||| |      ||||||||  ||| ||  |||| |||   
3'       uaau uu a  gugg  guu  ugcaa caggu   acg g      gaugaguc  ucc cg  aagu uau  u
   ------    g  c ug    -u   --     -     aca   u uaauga        uu   a  gu    a   gg 
Get sequence
Deep sequencing
11269 reads, 700 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chrX: 116755599-116755743 [-]
intergenic
Clustered miRNAs
< 10kb from eca-mir-506a
eca-mir-507achrX: 116755935-116756029 [-]
eca-mir-506achrX: 116755599-116755743 [-]
eca-mir-514achrX: 116750733-116750827 [-]
Database links

Mature sequence eca-miR-506a

Accession MIMAT0034707
Sequence

81 - 

ugaauggcaccuuucugaguagagu

 - 105

Get sequence
Deep sequencing9627 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).