Stem-loop sequence eca-mir-514b

AccessionMI0028343 (change log)
DescriptionEquus caballus miR-514b stem-loop
Gene family MIPF0000130; mir-506
Literature search

1 open access papers mention eca-mir-514b
(1 sentences)

Stem-loop
   ---------uc      cag    c     c    ag      a   g  gc 
5'            ugugcg   uacc cauuc agga  ugccaa cau ug  u
              ||||||   |||| ||||| ||||  |||||| ||| ||   
3'            acacgu   augg gugag uucu  acgguu gua au  a
   cagcaugaaca      --a    a     a    cu      c   a  ag 
Get sequence
Deep sequencing
216 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chrX: 116800086-116800180 [-]
intergenic
Clustered miRNAs
< 10kb from eca-mir-514b
eca-mir-514bchrX: 116800086-116800180 [-]
eca-mir-8908nchrX: 116796896-116797040 [-]
eca-mir-514chrX: 116793914-116794002 [-]
Database links

Mature sequence eca-miR-514b

Accession MIMAT0034706
Sequence

16 - 

ccauuccaggaagugccaaacaugu

 - 40

Get sequence
Deep sequencing29 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).