Stem-loop sequence eca-mir-507b

AccessionMI0028331 (change log)
DescriptionEquus caballus miR-507b stem-loop
Gene family MIPF0000130; mir-506
Stem-loop
   -g        c     -uuaaccauac   -   cag   uc     c           u   gg gua 
5'   caggguca uacau           ugu gug   ugc  cacuc aaagagugcca uca  u   g
     |||||||| |||||           ||| |||   |||  ||||| ||||||||||| |||  |    
3'   gucccggu gugua           aca cac   aug  gugag uuuuucacggu agu  g   g
   gg        u     caccagcauau   a   uua   gu     u           u   au aaa 
Get sequence
Deep sequencing
60 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chrX: 116771992-116772128 [-]
intergenic
Clustered miRNAs
< 10kb from eca-mir-507b
eca-mir-507bchrX: 116771992-116772128 [-]
eca-mir-508chrX: 116765762-116765878 [-]
Database links

Mature sequence eca-miR-507b

Accession MIMAT0034699
Sequence

77 - 

auuggcacuuuuuugagugug

 - 97

Get sequence
Deep sequencing39 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).