Stem-loop sequence eca-mir-9142

AccessionMI0028327 (change log)
DescriptionEquus caballus miR-9142 stem-loop
Stem-loop
   caaa  a   ucauuu  c      cug       g        ua     a      ag 
5'     gu ucu      gu uucuug   auccuca gacaaauc  uguug ugaauu  u
       || |||      || ||||||   ||||||| ||||||||  ||||| ||||||  a
3'     cg aga      ua aagagu   ugggagu cuguuuag  acaau acuuag  a
   --cc  a   uacauc  a      aaa       a        gc     g      gg 
Get sequence
Deep sequencing
4 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chrX: 115885618-115885738 [-]
intergenic
Clustered miRNAs
< 10kb from eca-mir-9142
eca-mir-9142chrX: 115885618-115885738 [-]
eca-mir-8908hchrX: 115879532-115879676 [-]
eca-mir-8908b-1chrX: 115877541-115877631 [-]
eca-mir-8908ichrX: 115876504-115876648 [-]
eca-mir-8908b-2chrX: 115875682-115875772 [-]
Database links

Mature sequence eca-miR-9142

Accession MIMAT0034695
Sequence

69 - 

ucaguaacacggauuugucauga

 - 91

Get sequence
Deep sequencing3 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).