Stem-loop sequence eca-mir-8908k-1

AccessionMI0028326 (change log)
DescriptionEquus caballus miR-8908k-1 stem-loop
Gene family MIPF0001890; mir-8908
Stem-loop
   -------uuccu   c uu    cau  ---a    ---   g   c          u            uuag 
5'             cca c  gagc   gc    gugu   gca ugc cuacccagaa ggugccgaauac    u
               ||| |  ||||   ||    ||||   ||| ||| |||||||||| ||||||||||||    c
3'             ggu g  cuug   cg    caca   cgu aug gaugggucuu ccacggcuuaug    u
   ggccaguauucc   u uu    --u  caag    acu   a   c          -            uaca 
Get sequence
Deep sequencing
1680 reads, 50 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chrX: 115865120-115865254 [-]
intergenic
Clustered miRNAs
< 10kb from eca-mir-8908k-1
eca-mir-8908echrX: 115874599-115874743 [-]
eca-mir-8908c-3chrX: 115873249-115873393 [-]
eca-mir-8908l-1chrX: 115871267-115871411 [-]
eca-mir-8908b-4chrX: 115870758-115870898 [-]
eca-mir-8908g-1chrX: 115869760-115869842 [-]
eca-mir-8908f-4chrX: 115868381-115868481 [-]
eca-mir-8908d-1chrX: 115867856-115867974 [-]
eca-mir-8908jchrX: 115867008-115867102 [-]
eca-mir-8908f-3chrX: 115866475-115866615 [-]
eca-mir-8908a-2chrX: 115865962-115866098 [-]
eca-mir-8908k-1chrX: 115865120-115865254 [-]
eca-mir-8908c-2chrX: 115864611-115864755 [-]
eca-mir-8908mchrX: 115862627-115862771 [-]
eca-mir-8908b-5chrX: 115862119-115862259 [-]
eca-mir-8908g-2chrX: 115861091-115861233 [-]
eca-mir-8908f-2chrX: 115859723-115859863 [-]
eca-mir-8908a-1chrX: 115859210-115859346 [-]
eca-mir-8908k-2chrX: 115858390-115858484 [-]
eca-mir-8908c-1chrX: 115857861-115858005 [-]
eca-mir-8908l-2chrX: 115855806-115855950 [-]
eca-mir-8908b-3chrX: 115855297-115855437 [-]
Database links

Mature sequence eca-miR-8908k

Accession MIMAT0034694
Sequence

36 - 

uacccagaauggugccgaauacuua

 - 60

Get sequence
Deep sequencing182 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).