Stem-loop sequence eca-mir-9141

AccessionMI0028325 (change log)
DescriptionEquus caballus miR-9141 stem-loop
Stem-loop
   -----------------------------guggcagcacagggggcuguccucccuccc     u   ----      aau ag   a 
5'                                                            cucag cau    uggacu   g  ccc g
                                                              ||||| |||    ||||||   |  |||  
3'                                                            gaguc gua    accugg   c  ggg c
   gaccgguccccugucgaccccucugggggaggaggacgacccugguucggguguuucgu     u   gucc      ggu cu   a 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr13: 40697020-40697164 [+]
sense
ENSECAT00000008193 ; PKD1-201; intron 17
ENSECAT00000008270 ; PKD1-202; intron 17
antisense
ENSECAT00000008427 ; E4F1-201; intron 1
Database links

Mature sequence eca-miR-9141

Accession MIMAT0034693
Sequence

81 - 

ucugagugcuuugugggcuuggucc

 - 105

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).