Stem-loop sequence eca-mir-7177b

AccessionMI0028323 (change log)
DescriptionEquus caballus miR-7177b stem-loop
Literature search

2 open access papers mention eca-mir-7177b
(2 sentences)

Stem-loop
   -----     a     ac    -------u     gu  cu             a     ---------      a  u 
5'      ugcuc uccau  gaag        gauua  uu  ccagggcacuagg gacca         cuuggu aa u
        ||||| |||||  ||||        |||||  ||  ||||||||||||| |||||         |||||| || a
3'      acgag aggua  cuuc        cuaau  aa  ggucucgugaucc cuggu         gaacca uu c
   auuag     a     -c    cacuuacu     ug  ag             c     aaaucucac      a  u 
Get sequence
Deep sequencing
76 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr13: 15364471-15364609 [+]
intergenic
Database links

Mature sequence eca-miR-7177b

Accession MIMAT0034691
Sequence

78 - 

aaaugguccccuagugcucugg

 - 99

Get sequence
Deep sequencing71 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).