Stem-loop sequence eca-mir-9124

AccessionMI0028306 (change log)
DescriptionEquus caballus miR-9124 stem-loop
Stem-loop
   agcugcgucugaaga   -             --     -   -      caug   ---ca     gu 
5'                cag gguuugcucuucu  ggacu guu gaguuc    agg     aguaa  u
                  ||| |||||||||||||  ||||| ||| ||||||    |||     |||||  c
3'                guc cuagaugggaagg  ucuga caa cucgag    ucc     ucauu  c
   -----------ggag   g             gg     a   u      -aaa   auuaa     ac 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr30: 27701557-27701677 [-]
intergenic
Database links

Mature sequence eca-miR-9124

Accession MIMAT0034675
Sequence

31 - 

uggacuguugaguuccaugaggc

 - 53

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).