Stem-loop sequence eca-mir-1379

AccessionMI0028305 (change log)
DescriptionEquus caballus miR-1379 stem-loop
Literature search

1 open access papers mention eca-mir-1379
(1 sentences)

Stem-loop
   cacu   au     a --g     ---   -   a          -  a   u  -       a   gugu  u 
5'     gga  gacug g   ggcuu   uca ggg gcccacgggc uc ggc cu cagcccg gcc    uc u
       |||  ||||| |   |||||   ||| ||| |||||||||| || ||| || ||||||| |||    ||  
3'     ccu  cuggc c   ccggg   ggu ccc cggguguccg ag ccg ga gucgggc cgg    ag c
   ----   gu     - aaa     ucg   a   -          c  -   c  c       a   --gu  a 
Get sequence
Deep sequencing
1176 reads, 50 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr30: 12533239-12533371 [+]
sense
ENSECAT00000005107 ; EPRS-201; intron 8
Database links

Mature sequence eca-miR-1379

Accession MIMAT0034674
Sequence

75 - 

gcacgggcugcagcgccgacgccu

 - 98

Get sequence
Deep sequencing1167 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).