Stem-loop sequence eca-mir-483

AccessionMI0028301 (change log)
DescriptionEquus caballus miR-483 stem-loop
Gene family MIPF0000180; mir-483
Literature search

2 open access papers mention eca-mir-483
(7 sentences)

Stem-loop
   -----      c uu  agccu    u       c                       ---  c  g  u 
5'      gcugag c  gg     gugg gggggag gggggaggacgggaggggaggag   gg gu gu u
        |||||| |  ||     |||| ||||||| |||||||||||||||||||||||   || || || u
3'      cggcuc g  cc     uacc cuccuuc ucuucuucugcccuccucuccuc   cc cg cg a
   cucgg      u -u  guccu    -       u                       acu  u  a  u 
Get sequence
Deep sequencing
376 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr12: 30634767-30634899 [-]
sense
ENSECAT00000026377 ; eca-mir-675-201; intron 1
ENSECAT00000026481 ; IGF2-201; intron 3
antisense
ENSECAT00000026368 ; MRPL23-201; intron 4
Database links

Mature sequence eca-miR-483

Accession MIMAT0034670
Sequence

75 - 

ucacuccucuccucccgucuucuu

 - 98

Get sequence
Deep sequencing361 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).