Stem-loop sequence eca-mir-9116

AccessionMI0028296 (change log)
DescriptionEquus caballus miR-9116 stem-loop
Stem-loop
   ---auccc      -a  c      uuu a   c  ucu    c     guc   -     -      -a     
5'         aggcug  cu guaggg   c cca cu   ucac uuuau   uca uaucu cugugu  cggg 
           ||||||  || ||||||   | ||| ||   |||| |||||   ||| ||||| ||||||  ||| g
3'         uucgac  ga cguccc   g ggu ga   agug aaaua   agu gugga gacaua  gucc 
   ggugcccu      cg  c      -cc a   a  -uc    u     ---   c     c      cg     
Get sequence
Deep sequencing
13 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr12: 20724724-20724860 [-]
intergenic
Clustered miRNAs
< 10kb from eca-mir-9116
eca-mir-9116chr12: 20724724-20724860 [-]
eca-mir-9113chr12: 20723744-20723862 [+]
eca-mir-9115chr12: 20718806-20718948 [-]
Database links

Mature sequence eca-miR-9116

Accession MIMAT0034665
Sequence

41 - 

uuuaugucucauaucucugug

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).