Stem-loop sequence eca-mir-9114

AccessionMI0028294 (change log)
DescriptionEquus caballus miR-9114 stem-loop
Stem-loop
   ----c   a  aa  g   a          a  c       u  gu 
5'      ugg ag  ug ugg gggccucacc uu uagcucu gg  c
        ||| ||  || ||| |||||||||| || ||||||| ||  a
3'      acc uc  ac guc cccggagugg ag gucgaga cc  g
   accca   c  -c  g   c          c  u       -  gu 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr12: 12240995-12241083 [+]
intergenic
Database links

Mature sequence eca-miR-9114

Accession MIMAT0034663
Sequence

16 - 

agggccucaccauucuagcucu

 - 37

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).