Stem-loop sequence eca-mir-9111

AccessionMI0028290 (change log)
DescriptionEquus caballus miR-9111 stem-loop
Stem-loop
   guauaugcauuu   u  u    gcag     -uccu       -----         cc     -----cc  cc   c 
5'             cca gu gcca    uccuu     aggugca     uccguggcc  agucc       gg  cag u
               ||| || ||||    |||||     |||||||     |||||||||  |||||       ||  |||  
3'             ggu ca cggu    gggag     uccgcgu     aggugcugg  ucggg       cc  guc u
   ------------   c  -    ----     cacau       gccua         -c     acucaua  cu   g 
Get sequence
Deep sequencing
3 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr12: 2512584-2512716 [+]
intergenic
Database links

Mature sequence eca-miR-9111

Accession MIMAT0034660
Sequence

36 - 

uaggugcauccguggccccagucc

 - 59

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).