Stem-loop sequence eca-mir-7035

AccessionMI0028284 (change log)
DescriptionEquus caballus miR-7035 stem-loop
Stem-loop
   --------uug     u  a     -   -         ggca     g        ucuguuu  -u   aa   --      
5'            ggucu gc cuucc ccu gcucuggag    ugcuu ugggcuac       ag  cua  acc  cagca 
              ||||| || ||||| ||| |||||||||    ||||| ||||||||       ||  |||  |||  |||| g
3'            ucagg cg gaggg ggg cgggaccuu    acgaa acucggug       uc  ggu  ugg  gucga 
   guaguccucua     c  g     u   u         --ac     g        -------  uu   cc   aa      
Get sequence
Deep sequencing
1 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr11: 1353795-1353939 [+]
intergenic
Database links

Mature sequence eca-miR-7035

Accession MIMAT0034654
Sequence

81 - 

uccugguucuguggcucagaagcac

 - 105

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).