Stem-loop sequence eca-mir-9106

AccessionMI0028283 (change log)
DescriptionEquus caballus miR-9106 stem-loop
Stem-loop
   cagaccucaa     ccauuc       cuuc   c        ---c    ------        acac 
5'           ggugu      uccugga    acg gaggcucu    gagg      uagggcug    u
             |||||      |||||||    ||| ||||||||    ||||      ||||||||     
3'           ucaca      aggauuu    ugc cuccgaga    cucc      gucccggc    c
   ------guug     ---uua       ----   -        cuuu    cucuua        cccu 
Get sequence
Deep sequencing
5 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr11: 4187516-4187634 [-]
sense
ENSECAT00000021647 ; PGS1-201; intron 3
Database links

Mature sequence eca-miR-9106

Accession MIMAT0034653
Sequence

31 - 

ucacgcgaggcucucgagguag

 - 52

Get sequence
Deep sequencing5 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).