Stem-loop sequence eca-mir-9098

AccessionMI0028275 (change log)
DescriptionEquus caballus miR-9098 stem-loop
Stem-loop
   gauc    ag    -  g    gucaug   u    u  c  ---   u      g     -a      gaggu 
5'     aucc  cagg gu uggu      cac cuca ga cu   ugg cgggac uagug  acccca     c
       ||||  |||| || ||||      ||| |||| || ||   ||| |||||| |||||  ||||||      
3'     uggg  gucc cg accg      gug gagu cu ga   acc guucug gucgc  uggggu     a
   -uuu    -g    u  g    ------   -    c  a  aac   -      a     gg      gaaga 
Get sequence
Deep sequencing
3 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr11: 979994-980128 [+]
intergenic
Clustered miRNAs
< 10kb from eca-mir-9098
eca-mir-9098chr11: 979994-980128 [+]
eca-mir-9102chr11: 988544-988686 [+]
Database links

Mature sequence eca-miR-9098

Accession MIMAT0034645
Sequence

36 - 

ugaccuuggucgggacguagugaac

 - 60

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).