Stem-loop sequence eca-mir-744

AccessionMI0028274 (change log)
DescriptionEquus caballus miR-744 stem-loop
Gene family MIPF0000431; mir-744
Literature search

2 open access papers mention eca-mir-744
(7 sentences)

Stem-loop
   --c  -    - -     -----g     -  --g      cu   -ag   u 
5'    ug gguu g ggcaa      gugcg gg   cuaggg  aac   cag c
      || |||| | |||||      ||||| ||   ||||||  |||   ||| u
3'    ac ccaa c ccguu      cacgc cc   gguccu  uug   guc u
   cca  u    u a     gucgua     a  aaa      --   gaa   a 
Get sequence
Deep sequencing
541 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr11: 54402144-54402236 [+]
sense
ENSECAT00000027173 ; MAP2K4-201; intron 4
Database links

Mature sequence eca-miR-744

Accession MIMAT0034644
Sequence

16 - 

ugcggggcuagggcuaacagcagu

 - 39

Get sequence
Deep sequencing539 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).