Stem-loop sequence eca-mir-3548

AccessionMI0028231 (change log)
DescriptionEquus caballus miR-3548 stem-loop
Gene family MIPF0000019; mir-8
Stem-loop
   ----c   c   - --     g ag      a   u  aa    g     a         a  -g  ga 
5'      ucc cag c  gggcg c  uggguc ccu ug  cauc uuacc gacaguguu ga  uc  g
        ||| ||| |  ||||| |  |||||| ||| ||  |||| ||||| ||||||||| ||  ||  c
3'      agg guc g  uccgc g  acccgg gga ac  guag aaugg cugucacga cu  ag  c
   ggugc   a   c ac     g --      -   c  cc    -     c         c  aa  ag 
Get sequence
Deep sequencing
121 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr2: 48454387-48454515 [+]
intergenic
Clustered miRNAs
< 10kb from eca-mir-3548
eca-mir-429chr2: 48453025-48453091 [-]
eca-mir-3548chr2: 48454387-48454515 [+]
eca-mir-200achr2: 48454404-48454493 [-]
eca-mir-200bchr2: 48455071-48455139 [-]
Database links

Mature sequence eca-miR-3548

Accession MIMAT0034603
Sequence

73 - 

cagcacuguccgguaagaugcc

 - 94

Get sequence
Deep sequencing90 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).