Stem-loop sequence eca-mir-9056

AccessionMI0028227 (change log)
DescriptionEquus caballus miR-9056 stem-loop
Stem-loop
   a    --cg     cua      -  g    c  cu   g    -     -c    a   cu    uu      
5'  gcgg    ccggc   guccgc gc agag gg  gcu gggc cgagg  ccgg gga  ggcc  ggagc 
    ||||    |||||   |||||| || |||| ||  ||| |||| |||||  |||| |||  ||||  |||| a
3'  cguc    gguug   cgggug cg ucuc cc  cgg cucg gcucc  gguc cuu  ccgg  cuucu 
   a    ugaa     ---      a  -    u  -u   g    a     uc    g   -c    -u      
Get sequence
Deep sequencing
13 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr1: 91711374-91711508 [-]
sense
ENSECAT00000024942 ; FAM103A1-201; intron 1
Database links

Mature sequence eca-miR-9056

Accession MIMAT0034600
Sequence

36 - 

uggggccgaggcccggaggacuggc

 - 60

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).