Stem-loop sequence eca-mir-1307

AccessionMI0028213 (change log)
DescriptionEquus caballus miR-1307 stem-loop
Gene family MIPF0000558; mir-1307
Literature search

1 open access papers mention eca-mir-1307
(1 sentences)

Stem-loop
   ---ccagcuga  uacugcc        c a   u       -a  u  a   gc   ucuaug 
5'            gu       acugccua c auc cgaccgg  cc cg ccg  ucg      u
              ||       |||||||| | ||| |||||||  || || |||  |||       
3'            ca       uggcggau g ugg gcuggcu  gg gc ggc  agc      u
   gaacuuuuaag  uacauac        a a   u       gc  u  -   uc   uaaccg 
Get sequence
Deep sequencing
893 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr1: 26935090-26935214 [+]
intergenic
Database links

Mature sequence eca-miR-1307

Accession MIMAT0034589
Sequence

71 - 

acucggcguggcgucggucguggua

 - 95

Get sequence
Deep sequencing486 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).