Stem-loop sequence eca-mir-9033-2

AccessionMI0028205 (change log)
DescriptionEquus caballus miR-9033-2 stem-loop
Gene family MIPF0002087; mir-9033
Stem-loop
   ---augg   ag  ggg     a     -gg  ---aau  g   -    a     u   ugca   ga  -  a 
5'        ccc  cu   gucgc accua   uc      cu acc ccaa ggcug gcu    cag  gc cc a
          |||  ||   ||||| |||||   ||      || ||| |||| ||||| |||    |||  || || g
3'        ggg  gg   cagcg ugggu   ag      ga ugg gguu ccgac cga    guc  cg gg g
   cgucgca   ag  --a     g     agg  gcaccu  g   a    -     c   ----   uc  u  a 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr25: 35426557-35426693 [+]
intergenic
Clustered miRNAs
< 10kb from eca-mir-9033-2
eca-mir-9038chr25: 35423203-35423347 [-]
eca-mir-9033-2chr25: 35426557-35426693 [+]
Database links

Mature sequence eca-miR-9033

Accession MIMAT0034575
Sequence

77 - 

ucugagcccagccuuggaggu

 - 97

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).