Stem-loop sequence eca-mir-9035

AccessionMI0028199 (change log)
DescriptionEquus caballus miR-9035 stem-loop
Stem-loop
   cuguaaaauggg g   u uu      --u   ug  guag           -c    aaau     ca 
5'             g uug u  ccuugg   uca  ga    cccuggggaga  gcug    ccacg  a
               | ||| |  ||||||   |||  ||    |||||||||||  ||||    |||||   
3'             u aac g  ggaacu   ggu  uu    ggggccccuuu  cggu    ggugu  a
   -----------a g   u gg      uuc   gu  auga           ua    -guu     ug 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr25: 36177810-36177934 [-]
intergenic
Database links

Mature sequence eca-miR-9035

Accession MIMAT0034577
Sequence

71 - 

ugugguuguggcauuuuccccgggg

 - 95

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).