Stem-loop sequence eca-mir-9023

AccessionMI0028187 (change log)
DescriptionEquus caballus miR-9023 stem-loop
Stem-loop
   ---aa  ag         gg     -   ----g       u   aaua      g        gug 
5'      gc  cuuuguccu  acuuc agc     agcuuug auu    cgguag uagugugg   u
        ||  |||||||||  ||||| |||     ||||||| |||    |||||| ||||||||    
3'      cg  ggagcgggg  ugaag ucg     uuggagc uaa    gucguc gucacacu   g
   gauug  ca         --     g   agucg       -   ---g      -        aaa 
Get sequence
Deep sequencing
11 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr26: 39963492-39963612 [-]
intergenic
Database links

Mature sequence eca-miR-9023

Accession MIMAT0034565
Sequence

31 - 

uuguauuaauacgguagguagug

 - 53

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).