Stem-loop sequence eca-mir-9021

AccessionMI0028184 (change log)
DescriptionEquus caballus miR-9021 stem-loop
Literature search

1 open access papers mention eca-mir-9021
(1 sentences)

Stem-loop
   uccuccuucaguuucuc      cu  g          c c    cu   ga       
5'                  cagaag  ga agugggcagc c uggc  gca  gguuag 
                    ||||||  || |||||||||| | ||||  |||  ||||| a
3'                  gucuuc  cu ucacuuguug g gccg  cgu  ccaaug 
   -ucagagcuccugugca      cu  g          a a    -u   --       
Get sequence
Deep sequencing
173 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr28: 45276597-45276709 [-]
sense
ENSECAT00000021791 ; BDNF-201; intron 1
Database links

Mature sequence eca-miR-9021

Accession MIMAT0034562
Sequence

65 - 

cugcugccgagaguuguucacugu

 - 88

Get sequence
Deep sequencing173 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).