Stem-loop sequence eca-mir-9011

AccessionMI0028173 (change log)
DescriptionEquus caballus miR-9011 stem-loop
Stem-loop
   -----aggccgugugg    agg      -    --ca ga     g   a          cacuu     uccg 
5'                 uggg   cgaggg uggu    g  cugcc ucg cagggcgacc     ugggc    a
                   ||||   |||||| ||||    |  ||||| ||| ||||||||||     |||||    g
3'                 accc   gcuccc gccg    c  gacgg ggu guuucgcugg     acucg    a
   cgggagugacgagggg    --g      c    acag gg     g   g          aacuu     ucua 
Get sequence
Deep sequencing
3 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr8: 20966149-20966291 [-]
intergenic
Database links

Mature sequence eca-miR-9011

Accession MIMAT0034552
Sequence

80 - 

uucaaggucgcuuuggugggggca

 - 103

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).