Stem-loop sequence eca-mir-8979

AccessionMI0028135 (change log)
DescriptionEquus caballus miR-8979 stem-loop
Stem-loop
   a  c   ga     ccg  c   a         gggug    ---      g   aa   a    ugu  ucug   c 
5'  uc cag  guguc   ac guc ccacuccug     ccug   cuggcu ugg  cag gucc   gc    ggc u
    || |||  |||||   || ||| |||||||||     ||||   |||||| |||  ||| ||||   ||    |||  
3'  ag guc  cauag   ug cgg ggugggggu     ggac   gacugg acc  guu cagg   cg    ucg u
   -  a   uc     uua  a   -         ----g    uag      g   gg   a    ugu  ----   g 
Get sequence
Deep sequencing
83 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr6: 24386894-24387038 [+]
intergenic
Database links

Mature sequence eca-miR-8979

Accession MIMAT0034516
Sequence

41 - 

ugcuggcuguggaacagaguccugu

 - 65

Get sequence
Deep sequencing45 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).