Stem-loop sequence eca-mir-7045

AccessionMI0028124 (change log)
DescriptionEquus caballus miR-7045 stem-loop
Stem-loop
   cgagugaca   u    ---u   ---g  g              a gg     u cc  u g 
5'          ggc uucc    uga    gu cuggcggccggggg g  ggagu g  cg g a
            ||| ||||    |||    || |||||||||||||| |  ||||| |  || |  
3'          ucg gagg    acu    cg gaccgccggccccc c  ucuca c  gc c g
   ---------   c    ugcu   ggca  g              - gg     - uc  u a 
Get sequence
Deep sequencing
3 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr5: 45556471-45556581 [+]
sense
ENSECAT00000017217 ; MRPL9-201; 3'UTR (exon 2)
Database links

Mature sequence eca-miR-7045

Accession MIMAT0034505
Sequence

26 - 

cuggcggccgggggagggggagu

 - 48

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).