Stem-loop sequence eca-mir-1388

AccessionMI0028115 (change log)
DescriptionEquus caballus miR-1388 stem-loop
Gene family MIPF0000805; mir-1388
Literature search

2 open access papers mention eca-mir-1388
(2 sentences)

Stem-loop
   cuccacc   c   -  ---------u        a   ca  a   u c             ---  ag 
5'        ggu gcc cu          gggcagug cuc  gg cug c aaccugagaaugg   ug  u
          ||| ||| ||          |||||||| |||  || ||| | |||||||||||||   ||   
3'        ccg cgg ga          cccgucgu gag  cc gac g uuggacucuugcu   ac  c
   ------a   u   u  cgaccccuuc        a   ua  c   u c             ggg  cu 
Get sequence
Deep sequencing
12292 reads, 650 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr22: 49647210-49647332 [-]
intergenic
Database links

Mature sequence eca-miR-1388

Accession MIMAT0034496
Sequence

31 - 

aggacuguccaaccugagaauggu

 - 54

Get sequence
Deep sequencing9958 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).