Stem-loop sequence eca-mir-154b

AccessionMI0028108 (change log)
DescriptionEquus caballus miR-154b stem-loop
Gene family MIPF0000018; mir-154
Literature search

1 open access papers mention eca-mir-154b
(2 sentences)

Stem-loop
   ugcagguuuu   ---a    --a   acuc   -------                  uu     -   c     - uuua 
5'           ccu    ccag   gcu    ggc       ggugcuugaagagagguc  ccaug aug auucg c    u
             |||    ||||   |||    |||       ||||||||||||||||||  ||||| ||| ||||| |     
3'           gga    gguc   cga    ccg       cuaugaauuuuuuuccag  gguac uac uaagc g    u
   ----------   gcag    cca   aauu   gucuaaa                  uu     a   -     a cuuu 
Get sequence
Deep sequencing
106 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr24: 42930413-42930553 [+]
intergenic
Clustered miRNAs
< 10kb from eca-mir-154b
eca-mir-3959chr24: 42921540-42921650 [+]
eca-mir-487achr24: 42921992-42922071 [+]
eca-mir-382chr24: 42924862-42924937 [+]
eca-mir-134chr24: 42925245-42925315 [+]
eca-mir-485chr24: 42925986-42926058 [+]
eca-mir-154achr24: 42930163-42930226 [+]
eca-mir-154bchr24: 42930413-42930553 [+]
eca-mir-496chr24: 42930990-42931092 [+]
eca-mir-377chr24: 42932739-42932807 [+]
eca-mir-541chr24: 42934714-42934797 [+]
eca-mir-409chr24: 42935634-42935712 [+]
eca-mir-412chr24: 42935784-42935863 [+]
eca-mir-369chr24: 42935933-42936002 [+]
eca-mir-410chr24: 42936264-42936337 [+]
eca-mir-656chr24: 42937011-42937088 [+]
Database links

Mature sequence eca-miR-154b

Accession MIMAT0034489
Sequence

79 - 

aaucauacaugguugaccuuuuu

 - 101

Get sequence
Deep sequencing16 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).