Stem-loop sequence eca-mir-329b

AccessionMI0028106 (change log)
DescriptionEquus caballus miR-329b stem-loop
Gene family MIPF0000110; mir-329
Stem-loop
   -----a     -u   a    uguc    uu a       cu           uu      c  u     uuuag 
5'       aucag  ggu uuca    ggug  a uugguac  gaagagagguu  cuaggu uc guuuc     u
         |||||  ||| ||||    ||||  | |||||||  |||||||||||  |||||| || |||||      
3'       ugguc  ccg aggu    ccac  u gacuaug  cuuuucuccaa  ggucca ag caaag     g
   uagacc     uu   g    ---u    cc a       ac           uu      -  -     uggga 
Get sequence
Deep sequencing
212 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr24: 42899649-42899789 [+]
intergenic
Clustered miRNAs
< 10kb from eca-mir-329b
eca-mir-379chr24: 42894643-42894709 [+]
eca-mir-411chr24: 42895895-42895976 [+]
eca-mir-299chr24: 42896363-42896425 [+]
eca-mir-380chr24: 42897592-42897652 [+]
eca-mir-1197chr24: 42898113-42898232 [+]
eca-mir-323chr24: 42898304-42898389 [+]
eca-mir-758chr24: 42898599-42898683 [+]
eca-mir-329achr24: 42899352-42899449 [+]
eca-mir-329bchr24: 42899649-42899789 [+]
eca-mir-494chr24: 42902171-42902251 [+]
eca-mir-1193chr24: 42902577-42902697 [+]
eca-mir-543chr24: 42904247-42904318 [+]
eca-mir-495chr24: 42906084-42906165 [+]
eca-mir-3958chr24: 42908032-42908174 [+]
Database links

Mature sequence eca-miR-329b

Accession MIMAT0034487
Sequence

79 - 

aacgaaccugguuaaccucuuuu

 - 101

Get sequence
Deep sequencing210 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).