Stem-loop sequence eca-mir-3959

AccessionMI0028102 (change log)
DescriptionEquus caballus miR-3959 stem-loop
Gene family MIPF0000126; mir-379
Stem-loop
   g  -   uguu   - au      ggaau    g  u      aga         uua 
5'  cc gag    guc c  gauagg     ggau gu gaucag   acauacauu   u
    || |||    ||| |  ||||||     |||| || ||||||   |||||||||    
3'  gg cuc    cag g  cuaucc     ccug ca cuaguc   uguauguag   c
   -  a   --uu   a ac      --auc    a  c      aac         uaa 
Get sequence
Deep sequencing
1435 reads, 50 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr24: 42921540-42921650 [+]
intergenic
Clustered miRNAs
< 10kb from eca-mir-3959
eca-mir-376bchr24: 42911856-42911937 [+]
eca-mir-376achr24: 42912234-42912301 [+]
eca-mir-1185chr24: 42914351-42914436 [+]
eca-mir-381chr24: 42916054-42916128 [+]
eca-mir-487bchr24: 42916520-42916603 [+]
eca-mir-539chr24: 42917365-42917442 [+]
eca-mir-889chr24: 42917940-42918017 [+]
eca-mir-544-2chr24: 42918692-42918781 [+]
eca-mir-655chr24: 42919594-42919690 [+]
eca-mir-3959chr24: 42921540-42921650 [+]
eca-mir-487achr24: 42921992-42922071 [+]
eca-mir-382chr24: 42924862-42924937 [+]
eca-mir-134chr24: 42925245-42925315 [+]
eca-mir-485chr24: 42925986-42926058 [+]
eca-mir-154achr24: 42930163-42930226 [+]
eca-mir-154bchr24: 42930413-42930553 [+]
eca-mir-496chr24: 42930990-42931092 [+]
Database links

Mature sequence eca-miR-3959

Accession MIMAT0034484
Sequence

64 - 

uguaugucaacugauccacaguc

 - 86

Get sequence
Deep sequencing207 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).