Stem-loop sequence eca-mir-8937-1

AccessionMI0028077 (change log)
DescriptionEquus caballus miR-8937-1 stem-loop
Gene family MIPF0001963; mir-8937
Stem-loop
   -----uggaa     a  a u  ----c     uuc     -   -  g a c       u 
5'           gccgc ca g ca     uuccc   ccguc cug ag g g gcugggu c
             ||||| || | ||     |||||   ||||| ||| || | | ||||||| c
3'           cggug gu c gu     aaggg   ggcgg gac uc c c cgacccg a
   acccguacac     g  c u  aucuc     -uc     a   g  g - -       u 
Get sequence
Deep sequencing
171 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr18: 3937365-3937475 [-]
intergenic
Database links

Mature sequence eca-miR-8937

Accession MIMAT0034466
Sequence

26 - 

ucccguccugagggagcgcuggg

 - 48

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).