Stem-loop sequence eca-mir-8917

AccessionMI0028052 (change log)
DescriptionEquus caballus miR-8917 stem-loop
Stem-loop
   -   --  g    ucgucucac     a   -  --  a   a     c  uu                
5'  cca  au cugg         agugg cag ag  ug gag gucag gg  ggggggcaagucucc 
    |||  || ||||         ||||| ||| ||  || ||| ||||| ||  |||||||||||||| a
3'  ggu  ug gacc         ucacc guc uc  ac cuu caguc cc  cuucccguucagaga 
   g   cu  g    ---------     -   c  ua  c   c     u  uu                
Get sequence
Deep sequencing
16 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr20: 33720962-33721082 [-]
sense
ENSECAT00000002831 ; RGL2-201; exon 15
Database links

Mature sequence eca-miR-8917

Accession MIMAT0034445
Sequence

69 - 

cuugcccuucuuccucugaccuu

 - 91

Get sequence
Deep sequencing16 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).